deposited data microarray data Search Results


data raw microarray data  (ATCC)
93
ATCC data raw microarray data
Data Raw Microarray Data, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pmc06250977__mmc3-255-3-32?v=ATCC
Average 93 stars, based on 1 article reviews
data raw microarray data - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
synthesis n a mit synthesis n a gelred biotium 41003 deposited data rna sequence data  (Biotium)
97
Biotium synthesis n a mit synthesis n a gelred biotium 41003 deposited data rna sequence data
Synthesis N A Mit Synthesis N A Gelred Biotium 41003 Deposited Data Rna Sequence Data, supplied by Biotium, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pmc07419720__mmc1-79-171-177?v=Biotium
Average 97 stars, based on 1 article reviews
synthesis n a mit synthesis n a gelred biotium 41003 deposited data rna sequence data - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier
rpn2232 deposited data microarray  (GE Healthcare)
97
GE Healthcare rpn2232 deposited data microarray
Rpn2232 Deposited Data Microarray, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm31618630-185-139-136?v=GE+Healthcare
Average 97 stars, based on 1 article reviews
rpn2232 deposited data microarray - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier
software environment (base) database  (Bioarray Inc)
90
Bioarray Inc software environment (base) database
Software Environment (Base) Database, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/10__1017_slash_s0007114508981411-55-7-5?v=Bioarray+Inc
Average 90 stars, based on 1 article reviews
software environment (base) database - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
data wes data chen  (Selleck Chemicals)
93
Selleck Chemicals data wes data chen
Data Wes Data Chen, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm39793578-549-179-158?v=Selleck+Chemicals
Average 93 stars, based on 1 article reviews
data wes data chen - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
data raw rna sequencing data  (Vector Laboratories)
96
Vector Laboratories data raw rna sequencing data
Data Raw Rna Sequencing Data, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm34320366-307-175-170?v=Vector+Laboratories
Average 96 stars, based on 1 article reviews
data raw rna sequencing data - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier
data microarray analysis ncbi gene expression omnibus geo database accession number  (fluidigm)
94
fluidigm data microarray analysis ncbi gene expression omnibus geo database accession number
Data Microarray Analysis Ncbi Gene Expression Omnibus Geo Database Accession Number, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm31167130-214-223-219?v=fluidigm
Average 94 stars, based on 1 article reviews
data microarray analysis ncbi gene expression omnibus geo database accession number - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier
microarray protocols  (Johns Hopkins HealthCare)
90
Johns Hopkins HealthCare microarray protocols
Microarray Protocols, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pmc07013041-192-27-25?v=Johns+Hopkins+HealthCare
Average 90 stars, based on 1 article reviews
microarray protocols - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
gene exp icam1 mm00516024 g1  (Thermo Fisher)
87
Thermo Fisher gene exp icam1 mm00516024 g1
Gene Exp Icam1 Mm00516024 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm30893599-301-12-10?v=Thermo+Fisher
Average 87 stars, based on 1 article reviews
gene exp icam1 mm00516024 g1 - by Bioz Stars, 2026-07
87/100 stars
  Buy from Supplier
ncbi gene expression omnibus geo database  (Biotechnology Information)
86
Biotechnology Information ncbi gene expression omnibus geo database
Ncbi Gene Expression Omnibus Geo Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pmc04580618-373-11-9?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi gene expression omnibus geo database - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
r1050 deposited data microarray  (Zymo Research)
99
Zymo Research r1050 deposited data microarray
KEY RESOURCES TABLE
R1050 Deposited Data Microarray, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pmc05847273-658-221-218?v=Zymo+Research
Average 99 stars, based on 1 article reviews
r1050 deposited data microarray - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
10004d deposited data raw  (Thermo Fisher)
99
Thermo Fisher 10004d deposited data raw
KEY RESOURCES TABLE
10004d Deposited Data Raw, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/deposited+data+microarray+data/pm31509748-187-63-61?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
10004d deposited data raw - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Developmental cell

Article Title: The DYT6 Dystonia Protein THAP1 Regulates Myelination Within The Oligodendrocyte Lineage

doi: 10.1016/j.devcel.2017.06.009

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Age and sex-matched littermate mice were used for all experiments. table ft1 table-wrap mode="anchored" t5 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-THAP1 Santacruz Cat# sc-98174 Rabbit anti-THAP1 Proteintech Cat# 12584-1-AP Rabbit anti-YY1 Santacruz Cat# sc-281 Mouse anti-YY1 Santacruz Cat# sc-7341 Normalized anti-Rabbit IgG Santacruz Cat# sc-2027 Rat anti-MBP Millipore Cat# MAB386 Mouse anti-Actin Sigma Cat# A53166 Rabbit anti-MOBP One World Lab Cat# AP6913a Mouse anti-MOG Millipore Cat# MAB5680 Mouse anti-CNP Sigma Cat# C5922 Mouse anti-β III - TUBULIN Millipore Cat# MAB1637 Rabbit anti-PLP1 This Study Provided by Dr. Roman Giger, University of Michigan Rabbit anti-MAG This Study Provided by Dr. Roman Giger, University of Michigan Mouse anti-MAG Millipore Cat# MAB1567 HRP conjugated Donkey Anti-Rabbit Pierce Cat# 31402 HRP conjugated Donkey Anti-Mouse Jackson Immunoresearch Cat# 115-035-003 Bacterial and Virus Strains N/A Biological Samples N/A Chemicals, Peptides, and Recombinant Proteins Murine FGF2 Peprotech Cat# 450-33 Murine EGF Peprotech Cat# AF-100-15 Murine PDGF-AA Peprotech Cat# 315-17 RAT CNTF Peprotech Cat# 450-50 Human NT3 Peprotech Cat# 450-03 2x SYBR Green qPCR Master Mix Bimake Cat# {"type":"entrez-nucleotide","attrs":{"text":"B21202","term_id":"2396256","term_text":"B21202"}} B21202 Dynabeads ProteinG Thermofisher Cat# 10003D Purmorphamine Cayman Chemical Cat# 483367-10-8 Neurobasal Thermofisher Cat# 21103049 DMEM/F12 Thermofisher Cat# 11320-033 DMEM High Glucose Thermofisher Cat# 11995040 Critical Commercial Assays VECTASTAIN ELITE ABC Kit Vector Laboratories Cat# PK-6100 SMART MMLV Reverse Transcriptase Clontech Cat# 639522 Quick-RNA MicroPrep Zymo Research Cat# R1050 Deposited Data Microarray This Study {"type":"entrez-geo","attrs":{"text":"GSE97372","term_id":"97372"}} GSE97372 Chip-Seq THAP1 ENCODE {"type":"entrez-geo","attrs":{"text":"GSM803408","term_id":"803408"}} GSM803408 Chip-Seq YY1 ENCODE {"type":"entrez-geo","attrs":{"text":"GSM803446","term_id":"803446"}} GSM803446 Experimental Models: Cell Lines Neural Stem Cells - NSC This Study N/A Oligodendrocyte Progenitor Cells - OPC This Study N/A HEK-293 ATCC CRL-1573 Experimental Models: Organisms/Strains N/A Oligonucleotides lox-F This Study TGCTGGGTGTTGGAAAATAA frt-F This Study GCATAGGACAGAGCCTTTCAG frt-R This Study GATGCCAATACCTGATTGGAG QRT - PCR This Study Table S6 qCHIP - PCR This Study Table S6 Recombinant DNA pSPORT-YY1 GE Dharmacon MMM1013-202761238 pDEST26 – FLAG-THAP1 This Study N/A pDEST26 – THAP1 This Study N/A Software and Algorithms Image J NIH https://imagej.nih.gov/ij/ Graphed Prism GraphPad https://graphpad.com/scientific-software/prism/ Other N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, SYBR Green Assay, Plasmid Preparation, Microarray, Quantitative RT-PCR, Software